EurekaMag.com logo
+ Main Category
Research: 36,903,181
+ Most Shared Content

+ Live Traffic Content
+ Follow Us

+ Latest Full Text Content


EurekaMag.com PDF full text articles

Species characteristic responses to catnip by undomesticated felids




, : Species characteristic responses to catnip by undomesticated felids. Journal of Chemical Ecology 2(2): 239-253

Large felids (33) belonging to 6 spp. [Lynx rufus, Panthera leo, P. onca, P. pardus, P. tigris, Puma concolor] were exposed to catnip [Nepeta cataria] and catnip extract. The species-characteristic response to catnip and the sensitivity of the response to various concentrations of catnip were examined. Putative relationships between catnip sensitivity, species range, age, estrous cycle and behavioral complexity are discussed. The behavioral response to catnip shown by the domestic cat is seen in several different large felids. Lions and jaguars were extremely sensitive to catnip compared to tigers, cougars and bobcats, who gave little or no response. Males and females of the same species tested alike. Reproductive-age adults were more sensitive than either aged or immature animals. Catnip responsiveness is not limited to the domestic cat, it is not limited to the female and it varies dramatically between species and age of felids.

Accession: 006454047 PDF Full Text: Upload

Submit PDF Full Text of Accession 006454047

No spam - Every submission is manually reviewed

Select a file (≤5MB):

Close Close

Other Research

Ontogenetic behavior, migration, and social behavior of pallid sturgeon, Scaphirhynchus albus, and shovelnose sturgeon, S. platorynchus, with notes on the adaptive significance of body color: We conducted laboratory studies on the ontogenetic behavior of free embryos (first life interval after hatching) and larvae (first feeding interval) of pallid and shovelnose sturgeon. Migration styles of both species were similar for timing of mig...

Pharmacokinetics of melphalan in myeloma patients undergoing an autograft

Plasmodium falciparum hrp3 promoter region is associated with stage-specificity and episomal recombination: The asexual blood stage of Plasmodium falciparum in the human host is comprised of morphologically distinct ring, trophozoite and schizont stages, each of which possesses a distinct pattern of gene expression. Episomal promoter recombination has...

New data on the geology of the Mouzaki region, Karditsa Province (continental Greece); relationship between the Pindic, Beotian and Ultra-Pindic series

Frequency of the cystic fibrosis DELTA-F 508 mutation in a population from Sao Paulo State, Brazil: Cystic fibrosis (CF) nonrelated patients (N = 24) from Sao Paulo State, Brazil, were screened for the presence of the DELTA-F 508 mutation by PCR amplification of the deletion region with the primers C16B(5'G=CCTGGATTATGCCTGGGCAC3') and C16D(5'GTT...

Identification of oral Actinomyces species using DNA probes: Oral Actinomyces comprise a major segment of both the supra- and subgingival microbiota; however, little is known about the distribution of individual species in different sites or clinical conditions. The purpose of the present investigation was...

Two cathelicidin genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar): Further to the previous finding of the rainbow trout rtCATH_1 gene, this paper describes three more cathelicidin genes found in salmonids: two in Atlantic salmon, named asCATH_1 and asCATH_2, and one in rainbow trout, named rtCATH_2. All the three...

Activity of two species of Calliphora Diptera during barometric pressure changes of natural magnitude

Observations concerning two species of Xiphinema: Xiphinema americanum and X. elongatum which surround banana roots in Caraguatatuba, Sao Paulo, Brazil are compared. Measurements of X. americanum from Caraguatatuba are somewhat smaller than those from the United States and Sqao Paulo, but larger...

Eine neue Catopsilia von Madagaskar: C. mabillei (p. 336), type in author's coll.

PCR-based assay for the detection of Curtobacterium flaccumfaciens pv flaccumfaciens in bean seeds: Aims: To develop a PCR-based protocol for the rapid, sensitive and specific detection of Curtobacterium flaccumfaciens pv. flaccumfaciens (Cff) in bean seeds. Methods and Results: A pair of PCR primers (CffFOR2-CffREV4), targeting the sequence of...

Operational and Microbiological Aspects of a Bioaugmented Two-Stage Biotrickling Filter Removing Hydrogen Sulfide and Dimethyl Sulfide

Energetic efforts to save patients with multiple traumatic intracranial hematomas discovery of rulesby way of practice

A modified Saccharomyces cerevisiae strain that consumes L-arabinose and produces ethanol: Metabolic engineering is a powerful method to improve, redirect, or generate new metabolic reactions or whole pathways in microorganisms. Here we describe the engineering of a Saccharomyces cerevisiae strain able to utilize the pentose sugar L-ara...

Recent investigations into the toxicity of known and unknown poisonous plants in the union of Souta Africa. XV: Rabbits and sheep were drenched with the juice, or fed on the dry leaves, bulbs or roots of the following plants: Agave americana, Nestlera muriculata, Manihot utilissima, Romulea macowanii, Salvia runcinata, Scilla sp., Lissochilus buchananii, an...