EurekaMag
+ Translate
+ Most Popular
Advantages and disadvantages of bordeaux mixture and of lime-sulphur used on apples in the growing season
Observations on the Umaria marine bed
10 years of hearing conservation in the Royal Air Force
Chocolate crumb - dairy ingredient for milk chocolate
Effect of daily gelatin ingestion on human scalp hair
Comparison of rice bran and maize bran as feeds for growing and fattening pigs
The composition of pampas-grass (Cortaderia argentea.)
The Accraian Series:
The mechanism of the Liebermann-Burchard reaction of sterols and triterpenes and their esters
Cerebrovascular Doppler ultrasound studies (cv-Doppler)
Toria: PT-303 - first national variety
Hair growth promoting activity of tridax procumbens
Productivity of Pekin x Khaki Campbell ducks
A stable cytosolic expression of VH antibody fragment directed against PVY NIa protein in transgenic potato plant confers partial protection against the virus
Solar treatment of wheat loose smut
Swimmers itch in the Lake of Garda
Bactofugation and the Bactotherm process
The effects of prefrontal lobotomy on aggressive behavior in dogs
Visual rating scales for screening whorl-stage corn for resistance to fall armyworm
Breakdown of seamounts at the trench axis, viewed from gravity anomaly
Kooken; pennsylvania's toughest cave
Recovery of new dinosaur and other fossils from the Early Cretaceous Arundel Clay facies (Potomac Group) of central Maryland, U.S.A
Zubor horny (Bison bonasus) v prirodnych podmienkach Slovensku
The extended Widal test in the diagnosis of fevers due to Salmonella infection
Hair of the american mastodon indicates an adaptation to a semi aquatic habitat

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum


CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum



Vaccine 21(23): 3307-3318



ISSN/ISBN: 0264-410X

PMID: 12804862

DOI: 10.1016/s0264-410x(03)00176-2

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Please choose payment method:






(PDF emailed within 0-6 h: $19.90)

Accession: 003696535

Download citation: RISBibTeXText

Related references

Immune response to porin in cattle immunized with whole cell, outer membrane, and outer membrane protein antigens of Brucella abortus combined with trehalose dimycolate and muramyl dipeptide adjuvants. Infection and Immunity 42(3): 1159-1167, 1983

Comparison of the class-1 outer membrane protein from B:15:P1.16 Neisseria meningitidis strains isolated from patients previously immunized with a serogroup B outer membrane protein vaccine in Norway. Microbial Pathogenesis 17(6): 425-430, 1994

Immunologic priming to capsular polysaccharide in infants immunized with Haemophilus influenzae type b polysaccharide-Neisseria meningitidis outer membrane protein conjugate vaccine. Journal of Pediatrics 111(1): 22-27, 1987

Antibody responses to recombinant protein fragments of the major outer membrane protein and polymorphic outer membrane protein POMP90 in Chlamydophila abortus-infected pregnant sheep. Clinical and Diagnostic Laboratory Immunology 12(6): 770-777, 2005

Adenoid lymphocyte responses to outer membrane protein P6 of nontypable Haemophilus influenzae in children with and without otitis media. Acta Oto-Laryngologica. Supplementum 523: 153-154, 1996

CD4(+) T-lymphocyte and immunoglobulin G2 responses in calves immunized with Anaplasma marginale outer membranes and protected against homologous challenge. Infection and Immunity 66(11): 5406-5413, 1998

Molecular basis of immunity to rickettsial infection conferred through outer membrane protein B. Infection and Immunity 79(6): 2303-2313, 2011

Priming with Chlamydia trachomatis major outer membrane protein (MOMP) DNA followed by MOMP ISCOM boosting enhances protection and is associated with increased immunoglobulin A and Th1 cellular immune responses. Infection and Immunity 68(6): 3074-3078, 2000

Differential Immune Responses in Mice Immunized with Recombinant Neutralizing Epitope Protein of Hepatitis E Virus Formulated with Liposome and Alum Adjuvants. Viral Immunology 29(6): 350-360, 2016

Immunization with a portion of rickettsial outer membrane protein A stimulates protective immunity against spotted fever rickettsiosis. Vaccine 20(5-6): 979-988, 2001

Evaluation of antibody responses to outer membrane vesicles (OMVs) and killed whole cell of Vibrio cholerae O1 El Tor in immunized mice. Iranian Journal of Microbiology 11(3): 212-219, 2019

Rickettsial outer-membrane protein B (rOmpB) mediates bacterial invasion through Ku70 in an actin, c-Cbl, clathrin and caveolin 2-dependent manner. Cellular Microbiology 11(4): 629-644, 2009

The major outer membrane protein rOmpB of spotted fever group rickettsiae functions in the rickettsial adherence to and invasion of Vero cells. Microbes and Infection 8(3): 801-809, 2006

Local and systemic antibody responses in mice immunized intranasally with native and detergent-extracted outer membrane vesicles from Neisseria meningitidis. Infection and Immunity 72(5): 2528-2537, 2004

The rickettsial outer-membrane protein A and B genes of Rickettsia australis, the most divergent rickettsia of the spotted fever group. International Journal of Systematic and Evolutionary Microbiology 50 Pt 5: 1775-1779, 2000