EurekaMag.com logo
+ Translate

Preparation of projectionless particles from influenza virus and their messenger activities in prokaryotic and eukaryotic systems


, : Preparation of projectionless particles from influenza virus and their messenger activities in prokaryotic and eukaryotic systems. Archives of Virology 56(1-2): 15-32

A fraction of projection-less particles was prepared from influenza A/Dunedin/4/73 and A/Victoria/3/75 (X-47) (H3N2) by detergent treatment and extraction into ether at 0.degree. C. The activity of this material in stimulating protein synthesis in vitro was studied and compared with that of isolated virion RNA using an RNA-dependent Escherichia coli system, and a wheat germ system. In the bacterial system the purified RNA had the highest template activity, while in the eukaryotic system, the disrupted particle preparation was by far the most active. Translation products were formed with immunological and electrophoretic properties similar to those of several influenza virion proteins. The experiments indicate that, when added in the form of disrupted projection-less particles, RNA from influenza A2 virus is utilized as a template by eukaryotic ribosomes.

Accession: 006173718

PMID: 343752

DOI: 10.1007/bf01317280

Download PDF Full Text: Preparation of projectionless particles from influenza virus and their messenger activities in prokaryotic and eukaryotic systems


Submit PDF Full Text

No spam - Every submission is manually reviewed

Due to poor quality, we do not accept files from Researchgate

Submitted PDF Full Texts will always be free for everyone
(We only charge for PDFs that we need to acquire)

Select a PDF file:
Close
Close

Related references

Ullrich A.; Bautz F.A.; Bautz E.K.F., 1973: Translation of phage messenger rna in prokaryotic and eukaryotic cell free protein synthesizing systems. Hoppe-Seyler's Zeitschrift fuer Physiologische Chemie 354(10/11): 1252-1253

Lamarche, N.; Matton, G.; Massie, B.; Fontecave, M.; Atta, M.; Dumas, F.; Gaudreau, P.; Langelier, Y., 1996: Production of the R2 subunit of ribonucleotide reductase from herpes simplex virus with prokaryotic and eukaryotic expression systems: higher activity of R2 produced by eukaryotic cells related to higher iron-binding capacity. The R2 subunit of ribonucleotide reductase from herpes simplex virus type 2 was overproduced with prokaryotic and eukaryotic expression systems. The recombinant R2 purified by a two-step procedure exhibited a 3-fold higher activity when produced i...

Pirtle, R.M.; Pirtle, I.L.; Inouye, M., 1978: Homologous nucleotide sequences between prokaryotic and eukaryotic messenger rna the 5 prime end sequence of the messenger rna of the lipo protein of the escherichia coli outer membrane. The sequence of the first 89 nucleotides at the 5'-end of the mRNA for the lipoprotein of the E. coli outer membrane is: GCUACAUGGAGAUUAACUCAAUCUAGAGGGUAUUAAUAAUGAAAGCUACUAAACUGGUACUGGGCGCGGUAAUCCUGGGUUCUACUCUG. The sequence of the first 72 n...

Wang, W-Chen.; Wu, C-Ying.; Lai, Y-Chin.; Lin, N-Sheng.; Hsu, Y-Heiu.; Hu, C-Chi., 2015: Characterization of the cryptic AV3 promoter of ageratum yellow vein virus in prokaryotic and eukaryotic systems. A cryptic prokaryotic promoter, designated AV3 promoter, has been previously identified in certain begomovirus genus, including ageratum yellow vein virus isolate NT (AYVV-NT). In this study, we demonstrated that the core nucleotides in the putati...

LuoMengCheng; TaoPan; XiaoGengFu; PanZiShu, 2008: Prokaryotic expression of NP protein of influenza A virus H5N1 and preparation of polyclonal antibody. The nucleoprotein (NP) gene fragment of an avian influenza A virus H5N1 (A/chicken/Hubei/489/2004) was amplified by polymerase chain reaction (PCR) from pMD-NP plasmid template (GenBank No AY77008) and then cloned into the prokaryotic expression v...

Reibel L., 1974: Translation of globin messenger rna among eukaryotic and prokaryotic organisms. Acta Biologica Et Medica Germanica6: 945-952

Stridh S.; Datema R.; Scholtissek C., 1985: The influenza a virus protein pb 1 undergoes a conformational rearrangement during messenger rna primed influenza virus messenger rna synthesis. Virus Research (SUPPL 1): 17

Lundquist R.E.; Lazar J.M.; Klein W.H.; Clark J.M.Jr, 1972: Translation of satellite tobacco necrosis virus rna part 2 initiation of in vitro translation in prokaryotic and eukaryotic systems. Biochemistry 11(11): 2014-2019

Ruigrok, R., W.H.; Baudin, F., 1995: Structure of influenza virus ribonucleoprotein particles: II. Purified RNA-free influenza virus ribonucleoprotein forms structures that are indistinguishable from the intact influenza virus ribonucleoprotein particles. Influenza virus nucleoprotein (NP) was purified from the virus and found to be virtually free from RNA. The morphology of the negatively stained NP was studied using electron microscopy. The monomer protein was found to be a small rod with dimensi...

Ruigrok, R.W.; Baudin, F., 1995: Structure of influenza virus ribonucleoprotein particles. II. Purified RNA-free influenza virus ribonucleoprotein forms structures that are indistinguishable from the intact influenza virus ribonucleoprotein particles. Influenza virus nucleoprotein (NP) was purified from the virus and found to be virtually free from RNA. The morphology of the negatively stained NP was studied using electron microscopy. The monomer protein was found to be a small rod with dimensi...