EurekaMag.com logo
+ Translate

The primary structure of messenger rna from escherichia coli constraints on nucleotides on the 3' side of codons


, : The primary structure of messenger rna from escherichia coli constraints on nucleotides on the 3' side of codons. Molekulyarnaya Biologiya (Moscow) 19(3): 791-799

The occurrence of nucleotides of the 3' side of codons has been determined in highly and weakly expressed genes from Escherichia coli. It was found that the usage of some amino acid condons in highly expressed genes was site specific, depending on the base 3' to the codon. The role of the 3' nucleotide as a modulator of codon translation effectiveness is discussed. The rules of synonymous codon usage in relation to the 3' flanking nucleotide have been established for highly expressed genes. For example, if a triplet next to the lysine codon starts with guanosine, lysine is preferably encoded by AAA and not by AAG (P < 10-8), while of cytidine is 3' to the lysine codon, AAG is preferred over AAA (P < 0.001). These rules are observed in highly and absent in weakly expressed mRNAs and can be used in the chemical synthesis of genes designed for expression in E. coli.

(PDF 0-2 workdays service)

Accession: 006740939

Submit PDF Full Text: Here


Submit PDF Full Text

No spam - Every submission is manually reviewed

Due to poor quality, we do not accept files from Researchgate

Submitted PDF Full Texts will always be free for everyone
(We only charge for PDFs that we need to acquire)

Select a PDF file:
Close
Close

Related references

Shpaer, E.G., 1985: Constraints on the nucleotide at the 5' side of codons in escherichia coli genes. The frequencies of occurrence of nucletodies at the 5' side of codons have been determined inhighly and weakly expressed genes from E. coli. Significant constraints on the nucleotide 5'to some codons were found in highly expressed genes....

Shpaer, E.G., 1985: Analysis of the primary structure of mRNA from Escherichia coli: occurrence of nucleotides on the 3'-side of the codon. The occurrence of nucleotides of the 3' side of codons has been determined in highly and weakly expressed genes from Escherichia coli. It was found that the usage of some amino acid codons in highly expressed genes was site specific, dependin...

Caskey C.T.; Beaudet A.; Nirenberg M., 1968: Rna codons and protein synthesis xv dissimilar responses of mammalian and bacterial transfer rna fractions to messenger rna m rna codons guinea pig escherichia coli. Journal of Molecular Biology 37(1): 99-118

Hanawa-Suetsugu, K.; Bordeau, V.; Himeno, H.; Muto, A.; Felden, B., 2001: Importance of the conserved nucleotides around the tRNA-like structure of Escherichia coli transfer-messenger RNA for protein tagging. A bacterial RNA functioning as both tRNA and mRNA, transfer-messenger RNA (tmRNA) rescues stalled ribosomes and clears the cell of incomplete polypeptides. For function, Escherichia coli tmRNA requires an elaborate interplay between a tRNA-like st...

Morse D.E.; Yanofsky C., 1970: Synthesis and degradation of messenger rna distal to nonsense codons in the trp operon of escherichia coli. Silvestri, L G (Edited By) Rna-Polymerase And Transcription Proceedings Of The First International Lepetit Colloquium, Held in Florence, Italy, November 1969 Ix + 339p Illus North-Holland Publishing Co , Amsterdam, Netherlands; American Elsevier Publishing Co , Inc , New York, N Y , U S A 204-207

Fuglsang, A., 2004: Nucleotides downstream of start codons show marked non-randomness in Escherichia coli but not in Bacillus subtilis. This study aimed at measuring the nucleotide non-randomness in the region downstream of start codons in bacterial genes and to see if the non-randomness differs between biased and unbiased genes, in terms of the effective number of codons (Nc) and...

Hanai, R.; Wada, A., 1989: Novel third-letter bias in Escherichia coli codons revealed by rigorous treatment of coding constraints. A novel bias in codon third-letter usage was found in Escherichia coli genes with low fractions of "optimal codons", by comparing intact sequences with control random sequences. Third-letter usage has been found to be biased according to...

Pirtle, R.M.; Pirtle, I.L.; Inouye, M., 1980: Messenger rna of the lipo protein of the escherichia coli outer membrane 1. nucleotide sequence at the 3' terminus and sequences of oligo nucleotides derived from complete digests of the messenger rna. The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of E. coli was determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. Thi...

Gao, W.; Tyagi, S.; Kramer, F.-Russell; Goldman, E., 1997: Messenger RNA release from ribosomes during 5'-translational blockage by consecutive low-usage arginine but not leucine codons in Escherichia coli. In '5'-translational blockage', significantly reduced yields of proteins are synthesized in Escherichia coli when consecutive low-usage codons are inserted near translation starts of messages (with reduced or no effect when these sa...

Gao, W.; Tyagi, S.; Kramer, F.R.; Goldman, E., 1997: Messenger RNA release from ribosomes during 5'-translational blockage by consecutive low-usage arginine but not leucine codons in Escherichia coli. In '5'-translational blockage', significantly reduced yields of proteins are synthesized in Escherichia coli when consecutive low-usage codons are inserted near translation starts of messages (with reduced or no effect when these sa...