+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

Survey of RAPD and SCAR markers linked to the Ur-6 gene for specific rust resistance in diverse bean cultivars/breeding lines



Survey of RAPD and SCAR markers linked to the Ur-6 gene for specific rust resistance in diverse bean cultivars/breeding lines



Hortscience 38(5): 803-804



Bean rust, caused by Uromyces appendiculatus, is an important disease of common bean. Coupling-phase RAPD marker OBC06.300 was previously reported to be tightly linked to the Ur-6 gene for specific rust resistance in an F2 population from the cross OlatheXNebr. 1 sel. 27. Merits of SCAR markers over RAPD have been reported. However, SCAR markers linked to the Ur-6 gene have not been reported. Our objectives were to convert the RAPD marker OBC06.300 tightly linked to the Ur-6 gene into a robust and reproducible SCAR marker for use as a selection tool and determine the presence or absence of the RAPD and SCAR markers linked to the gene in 51 Middle American and Andean bean cultivars/lines. To develop the SCAR marker from the RAPD marker OBC06.300, we designed a specific forward (GAAGGCGAGAAGAAAAAGAAAAAT) and reverse (GAAGGCGAGAGCACCTAGCTGAAG) 24-mer primer pair containing the original sequence (underlined) of BC06 primer. The SCAR marker amplified with the specific primer pair was present in Olathe and the resistant DNA bulk, whereas it was absent in Nebr.1 sel. 27 and the susceptible DNA bulk. The SCAR marker showed no recombination with the marker OBC06.300 in the F2 population from the cross OlatheXNebr. 1sel. 27. These markers were also present in resistant bean cultivars/lines having the Ur-6 gene. These RAPD and SCAR markers linked to the Ur-6 gene of Andean origin, along with other independent rust resistance genes, could be utilized to pyramid multiple genes into a bean cultivar for more durable rust resistance.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 035802294

Download citation: RISBibTeXText


Related references

Survey of molecular markers linked to the Ur-7 gene for specific rust resistance in diverse bean cultivars and breeding lines. Annual report: no 46 193-194, 2003

RAPD and SCAR markers linked to the Ur-6 Andean gene controlling specific rust resistance in common bean. Crop Science 44(5): 1799-1807, 2004

RAPD and SCAR markers linked to the Ur-6 Andean gene controlling specific rust resistance in common bean. Crop science- 44(5): 1799-1807, 2004

Development of a coupling-phase SCAR marker linked to the Ur-7 rust resistance gene and its occurrence in diverse common bean lines. Crop Science 48(1): 357-363, 2008

RAPD markers tightly linked to the Ur-6 gene of Andean origin controlling specific resistance to rust in common bean. Annual report: no 46 187-188, 2003

SCAR markers linked to the common bean rust resistance gene Ur-13. Tag. Theoretical and Applied Genetics. Theoretische und Angewandte Genetik 111(5): 972-979, 2005

SCAR, RAPD and RFLP markers linked to a dominant gene (Are) conferring resistance to anthracnose in common bean. Tag. Theoretical and Applied Genetics. Theoretische und Angewandte Genetik 88(6-7): 865-870, 1994

RAPD and SCAR markers linked to a gene conferring resistance to angular leaf spot in common bean. Journal of Phytopathology 148(2): 117-121, 2000

Inheritance of rust resistance and identification of RAPD markers linked to the resistance gene block in common bean cv. Ouro negro. Annual report 44(44): 105-106, 2001

Identification of RAPD markers linked to a major rust resistance gene block in common bean. Tag. Theoretical and Applied Genetics. Theoretische und Angewandte Genetik 86(4): 505-512, 1993

RAPD marker linked to gene for specific rust resistance in common bean. Annual report9(39): 59-60, 1996

Development of a SCAR marker linked to the Ur-6 gene for specific rust resistance in common bean. Annual report: no 46 189-190, 2003

Backcross assisted by RAPD markers to develop common bean lines with carioca type grains containing the Ur-11 rust resistance gene. Annual report: no 46 195-196, 2003

Identification of RAPD markers linked to a major gene for rust resistance and indeterminate growth habit using bulked segregant analysis in a common bean cross. Annual report0(40): 116-117, 1997

Molecular markers linked to the Ur-6 gene controlling specific rust resistance in common bean. Hortscience 35(3): 398, 2000