+ Site Statistics
References:
54,258,434
Abstracts:
29,560,870
PMIDs:
28,072,757
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan



First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan



Plant Disease 98(12): 1746



Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066446047

Download citation: RISBibTeXText

PMID: 30703901


Related references

First Association of Pedilanthus leaf curl virus, Papaya leaf curl virus, Cotton leaf curl Kokhran virus, and Papaya leaf curl betasatellite with Symptomatic Chilli Pepper in Pakistan. Plant Disease 101(12): 2155-2156, 2017

Papaya Leaf Curl Guangdong Virus and Ageratum Yellow Vein Virus Associated with Leaf Curl Disease of Tobacco in China. Journal of Phytopathology 161(3): 201-204, 2013

Association of tomato leaf curl Gujarat virus and tomato leaf curl Bangladesh betasatellite on papaya showing typical leaf curl symptoms in North India. 3 Biotech 8(5): 243, 2018

Tomato yellow leaf curl disease in Guangdong caused by Tomato leaf curl Taiwan virus. Journal of Agricultural Biotechnology 15(1): 119-123, 2007

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan. Plant Disease 94(5): 637, 2019

First Report of Okra enation leaf curl virus and Associated Cotton leaf curl Multan betasatellite and Cotton leaf curl Multan alphasatellite Infecting Cotton in Pakistan: A New Member of the Cotton Leaf Curl Disease Complex. Plant Disease 98(10): 1447, 2019

First Report of Papaya leaf curl virus Infecting Papaya Plants in Taiwan. Plant Disease 87(2): 204, 2019

First report of Papaya leaf curl virus infecting papaya plants in Taiwan. Plant Disease 87(2): 204, 2003

Pepper leaf curl Lahore virus requires the DNA B component of Tomato leaf curl New Delhi virus to cause leaf curl symptoms. Virology Journal 7: 367, 2011

Infectivity of Euphorbia leaf curl virus and interaction with Tomato yellow leaf curl China betasatellite. Archives of Virology 156(3): 517-521, 2011

Association of Papaya leaf curl virus with the leaf curl disease of grain amaranth (Amaranthus cruentus L.) in India. Phytoparasitica 43(1): 97-101, 2015

Molecular evidence for association of Tomato leaf curl New Delhi virus with leaf curl disease of papaya in India. Australasian Plant Disease Notes: 1, 152-155, 2008

Okra Enation Leaf Curl Virus in Papaya From Iran Displaying Severe Leaf CURL SYMPTOMS. Journal of Plant Pathology 98(3): 637-639, 2016

First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease. Plant Disease 97(3): 428, 2019

Tomato yellow leaf curl virus and Tomato leaf curl Taiwan virus invade south-east coast of China. Journal of Phytopathology (Berlin) 156(4): 217-221, 2008