+ Site Statistics
References:
54,258,434
Abstracts:
29,560,870
PMIDs:
28,072,757
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of Tomato mottle mosaic virus Infection of Pepper in China



First Report of Tomato mottle mosaic virus Infection of Pepper in China



Plant Disease 98(10): 1447



Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066446080

Download citation: RISBibTeXText

PMID: 30703948


Related references

First Report of Pepper veinal mottle virus Associated with Mosaic and Mottle Diseases of Tomato and Pepper in Mali. Plant Disease 94(3): 378, 2019

First report of Pepper veinal mottle virus associated with mosaic and mottle diseases of tomato and pepper in Mali. Plant Disease: 3, 378, 2010

First Report of Tomato Mottle Mosaic Virus in Tomato Crops in China. Plant Disease 2018: Pdis03180538pdn, 2018

Pseudomonas oleovorans Strain KBPF-004 Culture Supernatants Reduced Seed Transmission of Cucumber green mottle mosaic virus and Pepper mild mottle virus , and Remodeled Aggregation of 126 kDa and Subcellular Localization of Movement Protein of Pepper mild mottle virus. Plant Pathology Journal 33(4): 393-401, 2017

Proving synergy of co-infection of plant viruses Cucumber mosaic virus and pepper mottle virus in bell pepper. Phytopathology 93(6 Supplement): S64, 2003

Synergistic Disease in Pepper Caused by the Mixed Infection of Cucumber mosaic virus and Pepper mottle virus. Phytopathology 96(3): 240-247, 2008

Prevention of plant virus diseases by Mirabilis jalapa leaf extract Tomato yellow mottle virus in tomato (Lycopersicon esculentum), cucumber mosaic virus, cucumber green mottle mosaic virus in cucumber (Cucumis sativus. New botanistub 1982) 7(7): 87-91, 1982

First Report of Pepper veinal mottle virus in Tomato and Pepper in Taiwan. Plant Disease 93(1): 107, 2019

Detection and characterization of an isolate of Tomato mottle mosaic virus infecting tomato in China. Journal of Integrative Agriculture 17(5): 1207-1212, 2018

First Report of Natural Infection of Zucchini Green Mottle Mosaic Virus on Bottle Gourd in Guangxi, China. Plant Disease 2018: Pdis02180341pdn, 2018

First Report of Pepper mottle virus in Tomato. Plant Disease 86(2): 186, 2019

First report of Pepper mottle virus in tomato. Plant Disease 86(2): 186, 2002

First Report of Pepper mottle virus Infecting Tomato in Hawaii. Plant Disease 96(6): 917, 2019

Occurrence and distribution of pepper veinal mottle virus and cucumber mosaic virus in pepper in Ibadan, Nigeria. Virology Journal 9: 79, 2012

Survey of viruses infecting open-field pepper crops in Cote d'Ivoire and diversity of Pepper veinal mottle virus and Cucumber mosaic virus. Plant Pathology 67(6): 1416-1425, 2018