+ Site Statistics
References:
54,258,434
Abstracts:
29,560,870
PMIDs:
28,072,757
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States



First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States



Plant Disease 98(10): 1446



Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066446087

Download citation: RISBibTeXText

PMID: 30703955


Related references

Cucumber mosaic virus, tobacco streak virus, and cucumber mosaic virus satellite RNA associated with mosaic and ringspot symptoms in Ajuga reptans in Ohio. Plant Disease 81(10): 1214, 1997

Cucumber Mosaic Virus, Tobacco Streak Virus, and Cucumber Mosaic Virus Satellite RNA Associated with Mosaic and Ringspot Symptoms in Ajuga reptans in Ohio. Plant Disease 81(10): 1214, 2019

Tobacco streak virus broad bean wilt virus cucumber mosaic virus and alfalfa mosaic virus associated with ring spot of ajuga reptans in australia. Plant Disease 67(2): 221-224, 1983

Cucumber mosaic virus associated with ringspot and mosaic disease of Ajuga reptans. Phytopathology 84(10): 1155, 1994

Resistance of tomatoes (Lycopersicon esculentum var. cerasiforme Mill.) to potato virus Y, tobacco mosaic virus, tobacco ringspot virus, cucumber mosaic virus and a mixture of them under greenhouse conditions. Revista Chapingo 15(78): 69-73, 1992

Natural occurrence of cucumber mosaic virus with plum pox virus (sharka) and prunus necrotic ringspot virus in plum. 1976

Detection of squash mosaic virus (SqMV), zucchini yellow mosaic virus (ZYMV) and cucumber mosaic virus (CMV) in melon seeds. Bulgarian Journal of Agricultural Science 11(1): 49-59, 2005

Detection of 41 isolates of necrotic ringspot virus apple mosaic virus and prune dwarf virus in prunus and malus by enzyme linked immuno sorbent assay. Plant Disease 67(5): 536-538, 1983

Detection of squash mosaic virus, zucchini yellow mosaic virus and cucumber mosaic virus in cucurbit seeds. Bulgarian Journal of Agricultural Science 8(2/3): 201-210, 2002

Rose mosaic disease symptoms induced in roses by graft inoculation with both prunus necrotic ringspot virus and apple mosaic virus. Plant Pathology 33(2): 155-160, 1984

Some considerations about the relationship between the so called n virus of potato d and cucumber mosaic virus tobacco ringspot virus tobacco mosaic virus. Izvestiya Akademii Nauk Estonskoi SSR Seriya Biologicheskaya 17(3): 288-300, 1968

Field evaluation of transgenic squash containing single or multiple virus coat protein gene constructs for resistance to cucumber mosaic virus, watermelon mosaic virus 2, and zucchini yellow mosaic virus. Bio-Technology (New York) 13(13): 1458-1465, 1995

Reactivities of apple mosaic virus prunus necrotic ringspot virus monoclonal antibodies with apple mosaic virus and other ilarviruses. Phytopathology 75(11): 1353, 1985

The detection of prunus necrotic ringspot virus and arabis mosaic virus in hop in Poland by ELISA technique. Phytopathologica Polonica ( 12): 27-28, 1991

Detection of hop mosaic virus (HMV) and prunus necrotic ringspot virus (PNRSV) in different parts of hop plants using the ELISA technique. Phytopathologia Polonica ( 13): 73-78, 1997