+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World



First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World



Plant Disease 98(10): 1448



During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5' CGGTAAGATTGTAGGGTTCATGGTGG 3'; and MPVcp3603R 5' TGCTCCAGTGTCACGGAAGT 3', which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5' TGAGATACATGAGGACAGG 3'; and Tombus642R 5' AGCTTAAATACCGACAGTT 3'). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066446130

Download citation: RISBibTeXText

PMID: 30704001


Related references

A virus as the causal agent of spring yellows of lettuce and escarole Beet western yellows virus, Myzus persicae, Florida. Proceedings of the annual meeting of the Florida State Horticultural Societyub 1982) 94(94): 149-152, 1982

First Report of Beet pseudo yellows virus in Blackberry in the United States. Plant Disease 88(2): 223, 2004

First Report of Pepper vein yellows virus Infecting Sweet Pepper in Spain. Plant Disease 97(9): 1261, 2013

First Report of Pepper vein yellows virus Infecting Hot Pepper in Sudan. Plant Disease 98(10): 1446, 2014

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease. Plant Disease 87(11): 1398, 2003

First report of beet pseudo yellows virus in strawberry in the United States: a second crinivirus able to cause pallidosis disease. Plant Disease 87(11): 1398, 2003

A virus as the causal agent of spring yellows of lettuce and escarole. Proceedings of the Florida State Horticultural Society 1982; 94: 149-152, 1981

First Complete Genome Sequence of Pepper mild mottle virus from Chili Pepper in the United States. Genome Announcements 6(18):, 2018

First Report of Moroccan pepper virus on Lisianthus in Iran and Worldwide. Plant Disease 95(11): 1485, 2011

Sugar beet virus yellows in United States. Phytopath 42(7): 341, 1952

Sugar beet virus yellows situation in the United States. Proc Amer Soc Sugar Beet Technol : 540-548, 1952

Virus yellows of sugar beets and tests for its occurrence in the United States. Phytopath 41(6): 559, 1951

Pepper vein yellows virus, a novel luteovirus from bell pepper plants in Japan. Annals of the Phytopathological Society of Japan 61(3): 178-184, 1995

Aphid-transmitted yellows-type spinach virus in the eastern United States. Plant Dis Reporter 45(9): 720-721, 1961

First report of cucurbit aphid-borne yellows luteovirus in the United States. Plant Disease 77(11): 1169, 1993