+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China



First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China



Plant Disease 98(10): 1451



Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066446132

Download citation: RISBibTeXText

PMID: 30704003


Related references

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China. Plant Disease 98(5): 702, 2014

First Report of the Root-Knot Nematode Meloidogyne arenaria Infecting Noni in China. Plant Disease 97(11): 1518, 2013

First Report of Root-Knot Nematode Meloidogyne enterolobii on Guava in Vietnam. Plant Disease 93(6): 675, 2009

Meloidogyne enterolobii n. sp. (Meloidogynidae), a Root-knot Nematode Parasitizing Pacara Earpod Tree in China. Journal of Nematology 15(3): 381-391, 1983

First Report of the Peach Root-Knot Nematode, Meloidogyne floridensis Infecting Almond on Root-Knot Nematode Resistant 'Hansen 536' and 'Bright's Hybrid 5' Rootstocks in California, USA. Journal of Nematology 51: 1-3, 2019

First report of root-knot nematode Meloidogyne enterolobii on tomato and cucumber in Switzerland. Plant Disease: 9, 1370, 2008

First Report of Root-Knot Nematode Meloidogyne enterolobii on Tomato and Cucumber in Switzerland. Plant Disease 92(9): 1370, 2008

First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing Watermelon from Veracruz, Mexico. Plant Disease 98(3): 428, 2014

First Report of the Root-Knot Nematode, Meloidogyne hispanica, Infecting Sunflower in Greece. Plant Disease 98(5): 703, 2014

First Report of Root-Knot Nematode Meloidogyne arenaria Infecting Parsley in Turkey. Journal of Phytopathology 159(10): 694-696, 2011

First Report of Root-Knot Nematode Meloidogyne hispanica Infecting Grapevines in Southern Spain. Plant Disease 93(12): 1353, 2009

Meloidogyne enterolobii (= M. mayaguensis ): profile of an emerging, highly pathogenic, root-knot nematode species. Nematology 14(2): 133-138, 2012

First Report of the Root-Knot Nematode ( Meloidogyne javanica ) Infecting Hops ( Humulus lupulus ) in Florida, USA. Journal of Nematology 50(4): 543-544, 2018

Genetic diversity of the root-knot nematode Meloidogyne enterolobii and development of a SCAR marker for this guava-damaging species. Plant Pathology 59(6): 1054-1061, 2010

Effects of the Mi-1 and the N root-knot nematode-resistance gene on infection and reproduction of Meloidogyne enterolobii on tomato and pepper cultivars. Journal of Nematology 41(2): 134-139, 2009