+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland



First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland



Plant Disease 97(12): 1663



Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Please choose payment method:






(PDF emailed within 0-6 h: $19.90)

Accession: 066457658

Download citation: RISBibTeXText

PMID: 30716852

DOI: 10.1094/pdis-04-13-0382-pdn


Related references

First report of pospiviroids infecting ornamentals in the Netherlands Citrus exocortis viroid in Verbena sp, Potato spindle tuber viroid in Brugmansia suaveolens and Solanum jasminoides, and Tomato apical stunt viroid in Cestrum sp. Plant Pathology: 2, 399, 2008

First report of pospiviroids infecting ornamentals in the Netherlands: Citrus exocortis viroid in Verbena sp., Potato spindle tuber viroid in Brugmansia suaveolens and Solanum jasminoides, and Tomato apical stunt viroid in Cestrum sp. Plant Pathology 57(2): 399-399, 2008

Rasta Disease of Tomato in Ghana is Caused by the Pospiviroids Potato spindle tuber viroid and Tomato apical stunt viroid. Plant Disease 103(7): 1525-1535, 2019

First report of Solanum jasminoides infected by Citrus exocortis viroid in Germany and The Netherlands and Tomato apical stunt viroid in Belgium and Germany. 2008

First Report of Solanum jasminoides Infected by Citrus exocortis viroid in Germany and the Netherlands and Tomato apical stunt viroid in Belgium and Germany. Plant Disease 92(6): 973, 2008

First report of Potato spindle tuber viroid in Brugmansia spp, Solanum jasminoides, Solanum muricatum and Petunia spp in the Czech Republic. Plant Pathology: 2, 392, 2010

Host ranges ofPotato spindle tuber viroid,Tomato chlorotic dwarf viroid,Tomato apical stunt viroid, andColumnea latent viroidin horticultural plants. European Journal of Plant Pathology 141(1): 193-197, 2015

Seed transmission ofpotato spindle tuber viroid,tomato chlorotic dwarf viroid,tomato apical stunt viroid, andColumnea latent viroidin horticultural plants. European Journal of Plant Pathology 145(4): 1007-1011, 2016

Rapid detection of Hop stunt viroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid using isothermal AmplifyRP. Phytopathology 107(12): 54-55, 2017

Production of potato spindle tuber viroid by large scale fermentation of potato spindle tuber viroid infected potato cell solanum demissum suspension cultures. Journal of Experimental Botany 36(173): -1995, 1985

A viroid from Solanum pseudocapsicum closely related to the tomato apical stunt viroid. Archives of Virology 141(8): 1387-1395, 1996

Identification and characterization of Potato spindle tuber viroid infecting Solanum jasminoides and S-rantonnetii in Italy. Journal of Plant Pathology 89(2): 297-300, 2007

Natural infections of tomato by Citrus exocortis viroid, Columnea latent viroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid. European journal of plant pathology 110(8): 823-831, 2004

Effect of potato spindle tuber viroid on sexual reproduction and viroid transmission in true potato solanum tuberosum seed. Canadian Journal of Botany 64(2): 336-340, 1986

Viroid infection in potato (Solanum tuberosum L.) plants transformed with potato spindle tuber viroid cDNA. Archiv fur Phytopathologie und Pflanzenschutz 25(6): 611-614, 1989