+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease



First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease



Plant Disease 97(3): 428



Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066462225

Download citation: RISBibTeXText

PMID: 30722382


Related references

Quantification and localization of Watermelon chlorotic stunt virus and Tomato yellow leaf curl virus (Geminiviridae) in populations of Bemisia tabaci (Hemiptera, Aleyrodidae) with differential virus transmission characteristics. Plos one 9(11): E111968, 2014

Characterization of a synergistic interaction between two cucurbit-infecting begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus. Phytopathology 101(2): 281-289, 2011

Analysis of watermelon chlorotic stunt virus and tomato leaf curl Palampur virus mixed and pseudo-recombination infections. Virus Genes 51(3): 408-416, 2015

First report of simultaneous presence of Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl Israel virus infecting crops and weeds in Tunisia. Journal of Plant Pathology 90(1): 145, 2008

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan. Plant Disease 94(5): 637, 2010

Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: another emergent species in the Squash leaf curl virus clade. Virus Research 158(1-2): 257-262, 2011

Association of tomato leaf curl Gujarat virus and tomato leaf curl Bangladesh betasatellite on papaya showing typical leaf curl symptoms in North India. 3 Biotech 8(5): 243, 2018

Evidence that Watermelon Leaf Curl Disease in Pakistan Is Associated with Tomato Leaf Curl Virus-India, a Bipartite Begomovirus. Plant Disease 84(1): 102, 2000

Evidence that watermelon leaf curl disease in Pakistan is associated with tomato leaf curl virus-India, a bipartite begomovirus. Plant Disease 84(1): 102, 2000

Transreplication of a Tomato yellow leaf curl Thailand virus DNA-B and replication of a DNAbeta component by Tomato leaf curl Vietnam virus and Tomato yellow leaf curl Vietnam virus. Virus Research 136(1-2): 107-117, 2008

Melon chlorotic leaf curl virus: characterization and differential reassortment with closest relatives reveal adaptive virulence in the squash leaf curl virus clade and host shifting by the host-restricted bean calico mosaic virus. Journal of Virology 82(4): 1959-1967, 2008

Predominance of tomato leaf curl Gujarat virus as a monopartite begomovirus: association with tomato yellow leaf curl Thailand betasatellite. Archives of Virology 158(1): 217-224, 2013

Recent Emergence of the Mild Strain of Tomato yellow leaf curl virus as a Cause of Tomato Yellow Leaf Curl Disease of Processing Tomatoes (Solanum lycopersicon) in the Dominican Republic. Plant Disease 98(11): 1592, 2014

Detection of tomato yellow leaf curl virus and tomato yellow leaf curl sardinia virus with a general probe and species specific probes in tomato samples from Agadir, Morocco. Phytopathology 92(6 Suppl.): S74, 2002

First Association of Pedilanthus leaf curl virus, Papaya leaf curl virus, Cotton leaf curl Kokhran virus, and Papaya leaf curl betasatellite with Symptomatic Chilli Pepper in Pakistan. Plant Disease 101(12): 2155-2156, 2017