+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas



First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas



Plant Disease 94(6): 792



During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants ('Wichita') growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066487643

Download citation: RISBibTeXText

PMID: 30754341


Related references

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Hibiscus trionum in New York. Plant Disease 93(6): 673, 2019

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Brassica carinata in Florida. Plant Disease 96(10): 1581, 2019

First Report of Sclerotinia Stem Rot of Anemone Caused by Sclerotinia sclerotiorum in Korea. Plant Disease 97(7): 997, 2019

First report of Sclerotinia stem rot of chickpea caused by Sclerotinia sclerotiorum in North Dakota and Washington. Plant Disease 90(1): 114, 2006

First Report of Sclerotinia Stem Rot of Chickpea Caused by Sclerotinia sclerotiorum in North Dakota and Washington. Plant Disease 90(1): 114, 2019

First Report of Sclerotinia Stem Rot and Death of Osteospermum spp. Hybrid Cultivars Caused by Sclerotinia sclerotiorum in Louisiana. Plant Disease 89(8): 911, 2019

First report of sclerotinia stem rot and death of Osteospermum spp. hybrid cultivars caused by Sclerotinia sclerotiorum in Louisiana. Plant Disease 89(8): 911, 2005

First Report of Stem and Crown Rot of Garbanzo Caused by Sclerotinia minor in the United States and by Sclerotinia sclerotiorum in Arizona. Plant Disease 84(11): 1250, 2019

First report of stem and crown rot of garbanzo caused by Sclerotinia minor in the United States and by Sclerotinia sclerotiorum in Arizona. Plant Disease 84(11): 1250, 2000

First Report of Sclerotinia Stem and Twig Blight Caused by Sclerotinia sclerotiorum on Citrus volkameriana Rootstock in Italy. Plant Disease 95(8): 1030, 2019

First Report of Sclerotinia Stem Rot and Watery Soft Rot Caused by Sclerotinia sclerotiorum on Sand Rocket (Diplotaxis tenuifolia) in Italy. Plant Disease 89(11): 1241, 2019

First report of sclerotinia stem rot and watery soft rot caused by Sclerotinia sclerotiorum on sand rocket (Diplotaxis tenuifolia) in Italy. Plant Disease 89(11): 1241, 2005

Evaluation of disease forecasting variables for sclerotinia stem rot (Sclerotinia sclerotiorum) of canola. Canadian Journal of Plant Science 80(4): 889-898, 2000

Occurrence of stem rot on canola caused by Sclerotinia sclerotiorum in Argentina. Plant Disease 89(5): 530, 2005

Occurrence of Stem Rot on Canola Caused by Sclerotinia sclerotiorum in Argentina. Plant Disease 89(5): 530, 2019