+ Site Statistics
+ Search Articles
+ PDF Full Text Service
How our service works
Request PDF Full Text
+ Follow Us
Follow on Facebook
Follow on Twitter
Follow on LinkedIn
+ Subscribe to Site Feeds
Most Shared
PDF Full Text
+ Translate
+ Recently Requested

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius



First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius



Plant Disease 93(11): 1218



Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Please choose payment method:






(PDF emailed within 1 workday: $29.90)

Accession: 066487852

Download citation: RISBibTeXText

PMID: 30754604


Related references

First report ofCarrot red leaf virus-associated RNA co-infecting carrot withCarrot red leaf virusandCarrot mottle mimic virusto cause carrot motley dwarf disease in New Zealand. Australasian Plant Disease Notes 4(1): 15-16, 2009

Carrot mottle mimic virus (CMoMV): a second umbravirus associated with carrot motley dwarf disease recognised by nucleic acid hybridisation. Molecular Plant Pathology On line: 1111gibbs, 1996

Incidence of carrot thin leaf virus and carrot motley dwarf virus diseases in commercial carrots grown in washington state during 1974 and 1975. Plant Disease Reporter 60(12): 1047-1049, 1976

The role of weed hosts volunteer carrots and overlapping growing seasons in the epidemiology of carrot thin leaf virus and carrot motley dwarf virus in central washington. Plant Disease Reporter 61(3): 217-222, 1977

Viral dieback of carrot and other Umbelliferae caused by the Anthriscus strain of parsnip yellow fleck virus, and its distinction from carrot motley dwarf. Netherlands Journal of Plant Pathology 91(4): 169-187, 1985

Viral dieback of carrot daucus carota ssp sativus and other umbelliferae caused by the anthriscus strain of parsnip yellow fleck virus and its distinction from carrot motley dwarf. Netherlands Journal of Plant Pathology 91(4): 169-188, 1985

Further evidence on the nature of the dependence of carrot mottle virus on carrot red leaf virus from transmission by aphids cavariella aegopodii. Annals of Applied Biology 103(3): 455-464, 1983

Further evidence on the nature of the dependence of carrot mottle virus on carrot red leaf virus for transmission by aphids. Annals of Applied Biology 1033: 455-464, 1983

Relations of carrot red leaf virus and carrot mottle virus with their aphid vector cavariella aegopodii. Annals of Applied Biology 89(2): 237-244, 1978

Aphid injection experiments with carrot mottle virus and its helper virus carrot red leaf. Annals of Applied Biology 89(2): 245-250, 1978

Willow-carrot aphid and Carrot motley dwarf in Yorkshire 1962-65. Expl Hort 20: 80-90, 1969

Nucleotide sequence of a satellite RNA associated with carrot motley dwarf in parsley and carrot. Virus Genes 38(1): 187-188, 2009

Carrot motley dwarf disease on carrot and parsley in Belgium. Mededelingen van de Faculteit Landbouwwetenschappen, Rijksuniversiteit Gent 52(3a): 1019-1025, 1987

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany. Archives of Virology 153(11): 2163-2165, 2008

Small spherical virus particles found in carrot plants daucus carota infected with carrot red leaf virus. Annals Of The Phytopathological Society Of Japan: 74-76, 1979